Review



maxima first strand cdna synthesis kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Thermo Fisher maxima first strand cdna synthesis kit
    Synthetic mRNA encoding ETV2 is efficiently translated into functional protein in vitro (A) EGFP or ETV2 protein expression at 15 h after mRNA transfection with MessengerMAX. Representative blight filed image and fluorescence image. Scale bars, 75 μm. TF, transfection reagent. (B) After mRNA transfection with MessengerMAX, the cells were collected at 24, 48, or 72 h time point. Total RNA extraction, <t>cDNA</t> <t>synthesis,</t> and qPCR analysis by ΔΔCT method were conducted. For each condition, n = 4; mean ± SD. ∗∗ p < 0.01 by two-way ANOVA with Bonferroni correction. (C) CDH5 protein expression at 24, 48, and 72 h time points after mRNA transfection were analyzed by western Blotting. The number above each gel lane represent the fold-change in intensity relative to control (TF only, 24 h).
    Maxima First Strand Cdna Synthesis Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/maxima+first+strand+cdna+synthesis+kit/revertaid+first+strand+cdna+synthesis+kit/pmc12221739-160-16-22
    Average 90 stars, based on 1 article reviews
    maxima first strand cdna synthesis kit - by Bioz Stars, 2026-09
    90/100 stars

    Images

    1) Product Images from "mRNA-based in vivo induction of ETV2 to restore blood flow in a preclinical mouse hindlimb ischemia model"

    Article Title: mRNA-based in vivo induction of ETV2 to restore blood flow in a preclinical mouse hindlimb ischemia model

    Journal: Molecular Therapy. Nucleic Acids

    doi: 10.1016/j.omtn.2025.102592

    Synthetic mRNA encoding ETV2 is efficiently translated into functional protein in vitro (A) EGFP or ETV2 protein expression at 15 h after mRNA transfection with MessengerMAX. Representative blight filed image and fluorescence image. Scale bars, 75 μm. TF, transfection reagent. (B) After mRNA transfection with MessengerMAX, the cells were collected at 24, 48, or 72 h time point. Total RNA extraction, cDNA synthesis, and qPCR analysis by ΔΔCT method were conducted. For each condition, n = 4; mean ± SD. ∗∗ p < 0.01 by two-way ANOVA with Bonferroni correction. (C) CDH5 protein expression at 24, 48, and 72 h time points after mRNA transfection were analyzed by western Blotting. The number above each gel lane represent the fold-change in intensity relative to control (TF only, 24 h).
    Figure Legend Snippet: Synthetic mRNA encoding ETV2 is efficiently translated into functional protein in vitro (A) EGFP or ETV2 protein expression at 15 h after mRNA transfection with MessengerMAX. Representative blight filed image and fluorescence image. Scale bars, 75 μm. TF, transfection reagent. (B) After mRNA transfection with MessengerMAX, the cells were collected at 24, 48, or 72 h time point. Total RNA extraction, cDNA synthesis, and qPCR analysis by ΔΔCT method were conducted. For each condition, n = 4; mean ± SD. ∗∗ p < 0.01 by two-way ANOVA with Bonferroni correction. (C) CDH5 protein expression at 24, 48, and 72 h time points after mRNA transfection were analyzed by western Blotting. The number above each gel lane represent the fold-change in intensity relative to control (TF only, 24 h).

    Techniques Used: Functional Assay, In Vitro, Expressing, Transfection, Fluorescence, RNA Extraction, cDNA Synthesis, Western Blot, Control

    Related Articles

    Reverse Transcription:

    Article Title: Four ZIPs contribute to Zn, Fe, Cu and Mn acquisition at the outer root domain.
    Article Snippet: RNAs were extracted using a TRIzol-adapted RNeasy MinElute CleanupKit (Qiagen). .. Subsequently, RNAs were reverse transcribed with a Thermo Scientific Maxima First Strand cDNA Synthesis Kit following the manufacturer’s protocol. .. Quantitative Real-time PCR was conducted on an Applied Biosystems QuantStudio5 thermo-cycler using Applied Biosystems SYBR Green master mix.

    Article Title: Developmental and quantitative expression profile of the six pollen allergens of mugwort (Artemisia vulgaris L.).
    Article Snippet: To remove DNA remnants, the total RNA was treated with DNase I (TURBO DNA free Kit, Ambion). .. Then a reverse transcription reaction was performed with Maxima First Strand cDNA Synthesis Kit (Thermo Scientific), using 500 ng RNA extracted from pure pollen and inflorescences (containing pollen at three development stages), according to protocol and producer’s recommendation attached to the kit. ..

    Article Title: mRNA-based in vivo induction of ETV2 to restore blood flow in a preclinical mouse hindlimb ischemia model
    Article Snippet: At 15, 24, 48, or 72 h, the cells were washed with PBS and lysed with RLT RNeasy Plus lysis buffer (a component of RNeasy Mini Kit, QIAGEN, Germantown, MD) containing 2-mercaptoethanol or radioimmunoprecipitation assay (RIPA) buffer containing phosphatase/protease inhibitors. .. Total RNA was extracted with an RNeasy Min kit and reverse transcribed to cDNA with a Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific), followed by RT-qPCR using TaqMan Probes and TaqMan fast Advanced Master Mix (Applied Biosystems, Waltham, MA) and CFX Opus 384 Real-Time PCR system (Bio-Rad, Hercules, CA) to assess mRNA expression levels of CDH5 , KDR , PECAM1 , and GAPDH (TaqMan Probes ID nos. .. Hs00901465_m1, Hs00911700_m1, Hs01065279_m1, and Hs02786624_g1).

    Article Title: Subclonal immune evasion in non-small cell lung cancer.
    Article Snippet: To determine NOA1 expression, RNA was isolated using RNeasy mini kit (Qiagen). .. 300 ng RNA was reverse transcribed using Maxima First Strand cDNA Synthesis Kit (ThermoScientific). .. NOA1 (FWD: CCTGCAGGGAAATCAGTCAG, REV: TCCACCCAT TGGAATCTGGA) RNA expression was measured by qPCR using a SensiFAST SYBR Hi-ROX kit (Meridian Bioscience) on a QuantStudio 3 (ThermoFisher) using GAPDH (FWD: TTAAAAGCAGCCCTGGTGAC, REV: CTCTGCTCCTCCTGTTCGAC) as reference gene.

    Article Title: Senescence-associated alterations in histone H3 modifications, HP1 alpha levels and distribution, and in the transcriptome of vascular smooth muscle cells in different types of senescence.
    Article Snippet: .. Analysis of mRNA levels using real-time PCR (qPCR) The reverse transcription reaction was performed using the Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) according to the manufacturer’s instructions. .. The reaction was performed in a Mastercycler® nexus thermal cycler (Eppendorf ) using 1 μg of RNA isolated as described in 2.4.

    Article Title:
    Article Snippet: 32 June 2023 463 Molecular Therapy: Nucleic Acids DNA-free DNase Treatment (Thermo Fisher Scientific) was used to remove DNA contamination from the RNA samples. .. Total RNA was reverse transcribed into cDNA using the Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific), and qPCR was performed using the TaqMan ready-to-use primer-probe from Gene Expression Assay (Thermo Fisher Scientific): Angptl3 (Assay ID: Mm00803820_ m1). mRNA expression levels were normalized to mouse Actb (Assay ID: Mm01205647_g1) as an internal control, and the level of gene expression was calculated relative tomiSCR-injected mice. .. Liver miAngE measurements in WT and dyslipidemic mice RNA was extracted from mouse livers as previously described and reverse transcribed using the TaqManMicroRNA Reverse Transcription kit (Thermo Fisher Scientific) and a custom stem-loop primer specific for miAngE 23 nucleotide (variant T).

    cDNA Synthesis:

    Article Title: Four ZIPs contribute to Zn, Fe, Cu and Mn acquisition at the outer root domain.
    Article Snippet: RNAs were extracted using a TRIzol-adapted RNeasy MinElute CleanupKit (Qiagen). .. Subsequently, RNAs were reverse transcribed with a Thermo Scientific Maxima First Strand cDNA Synthesis Kit following the manufacturer’s protocol. .. Quantitative Real-time PCR was conducted on an Applied Biosystems QuantStudio5 thermo-cycler using Applied Biosystems SYBR Green master mix.

    Article Title: Developmental and quantitative expression profile of the six pollen allergens of mugwort (Artemisia vulgaris L.).
    Article Snippet: To remove DNA remnants, the total RNA was treated with DNase I (TURBO DNA free Kit, Ambion). .. Then a reverse transcription reaction was performed with Maxima First Strand cDNA Synthesis Kit (Thermo Scientific), using 500 ng RNA extracted from pure pollen and inflorescences (containing pollen at three development stages), according to protocol and producer’s recommendation attached to the kit. ..

    Article Title: A pair of GPI-anchored proteins regulate soybean immunity and disease resistance in coordination with GmLMM1 and GmRALFs.
    Article Snippet: .. Samples were separated on an SDS-PAGE gel and protein interactions were examined by anti-HIS immunoblotting. qRT-PCR and RNA-seq assays Plant total RNA was isolated using Eastep Super Total RNA Extraction Kit (Promega) according to the manufacturer’s instructions. cDNA was synthesized using Maxima First Strand cDNA Synthesis Kit (Thermo) and qRT-PCR was performed using SYBR Premix Ex Taq Kit (Takara). ..

    Article Title: mRNA-based in vivo induction of ETV2 to restore blood flow in a preclinical mouse hindlimb ischemia model
    Article Snippet: At 15, 24, 48, or 72 h, the cells were washed with PBS and lysed with RLT RNeasy Plus lysis buffer (a component of RNeasy Mini Kit, QIAGEN, Germantown, MD) containing 2-mercaptoethanol or radioimmunoprecipitation assay (RIPA) buffer containing phosphatase/protease inhibitors. .. Total RNA was extracted with an RNeasy Min kit and reverse transcribed to cDNA with a Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific), followed by RT-qPCR using TaqMan Probes and TaqMan fast Advanced Master Mix (Applied Biosystems, Waltham, MA) and CFX Opus 384 Real-Time PCR system (Bio-Rad, Hercules, CA) to assess mRNA expression levels of CDH5 , KDR , PECAM1 , and GAPDH (TaqMan Probes ID nos. .. Hs00901465_m1, Hs00911700_m1, Hs01065279_m1, and Hs02786624_g1).

    Article Title: Differential chromatin response to retinoic acid in neuroblastoma according to type of ATRX mutation
    Article Snippet: .. RNA was isolated from cells using the Qiagen RNeasy kit and cDNA synthesized using the Maxima First Strand cDNA synthesis kit (ThermoFisher). ..

    Article Title: Subclonal immune evasion in non-small cell lung cancer.
    Article Snippet: To determine NOA1 expression, RNA was isolated using RNeasy mini kit (Qiagen). .. 300 ng RNA was reverse transcribed using Maxima First Strand cDNA Synthesis Kit (ThermoScientific). .. NOA1 (FWD: CCTGCAGGGAAATCAGTCAG, REV: TCCACCCAT TGGAATCTGGA) RNA expression was measured by qPCR using a SensiFAST SYBR Hi-ROX kit (Meridian Bioscience) on a QuantStudio 3 (ThermoFisher) using GAPDH (FWD: TTAAAAGCAGCCCTGGTGAC, REV: CTCTGCTCCTCCTGTTCGAC) as reference gene.

    Article Title: Senescence-associated alterations in histone H3 modifications, HP1 alpha levels and distribution, and in the transcriptome of vascular smooth muscle cells in different types of senescence.
    Article Snippet: .. Analysis of mRNA levels using real-time PCR (qPCR) The reverse transcription reaction was performed using the Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) according to the manufacturer’s instructions. .. The reaction was performed in a Mastercycler® nexus thermal cycler (Eppendorf ) using 1 μg of RNA isolated as described in 2.4.

    Article Title:
    Article Snippet: 32 June 2023 463 Molecular Therapy: Nucleic Acids DNA-free DNase Treatment (Thermo Fisher Scientific) was used to remove DNA contamination from the RNA samples. .. Total RNA was reverse transcribed into cDNA using the Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific), and qPCR was performed using the TaqMan ready-to-use primer-probe from Gene Expression Assay (Thermo Fisher Scientific): Angptl3 (Assay ID: Mm00803820_ m1). mRNA expression levels were normalized to mouse Actb (Assay ID: Mm01205647_g1) as an internal control, and the level of gene expression was calculated relative tomiSCR-injected mice. .. Liver miAngE measurements in WT and dyslipidemic mice RNA was extracted from mouse livers as previously described and reverse transcribed using the TaqManMicroRNA Reverse Transcription kit (Thermo Fisher Scientific) and a custom stem-loop primer specific for miAngE 23 nucleotide (variant T).

    SDS Page:

    Article Title: A pair of GPI-anchored proteins regulate soybean immunity and disease resistance in coordination with GmLMM1 and GmRALFs.
    Article Snippet: .. Samples were separated on an SDS-PAGE gel and protein interactions were examined by anti-HIS immunoblotting. qRT-PCR and RNA-seq assays Plant total RNA was isolated using Eastep Super Total RNA Extraction Kit (Promega) according to the manufacturer’s instructions. cDNA was synthesized using Maxima First Strand cDNA Synthesis Kit (Thermo) and qRT-PCR was performed using SYBR Premix Ex Taq Kit (Takara). ..

    Western Blot:

    Article Title: A pair of GPI-anchored proteins regulate soybean immunity and disease resistance in coordination with GmLMM1 and GmRALFs.
    Article Snippet: .. Samples were separated on an SDS-PAGE gel and protein interactions were examined by anti-HIS immunoblotting. qRT-PCR and RNA-seq assays Plant total RNA was isolated using Eastep Super Total RNA Extraction Kit (Promega) according to the manufacturer’s instructions. cDNA was synthesized using Maxima First Strand cDNA Synthesis Kit (Thermo) and qRT-PCR was performed using SYBR Premix Ex Taq Kit (Takara). ..

    Quantitative RT-PCR:

    Article Title: A pair of GPI-anchored proteins regulate soybean immunity and disease resistance in coordination with GmLMM1 and GmRALFs.
    Article Snippet: .. Samples were separated on an SDS-PAGE gel and protein interactions were examined by anti-HIS immunoblotting. qRT-PCR and RNA-seq assays Plant total RNA was isolated using Eastep Super Total RNA Extraction Kit (Promega) according to the manufacturer’s instructions. cDNA was synthesized using Maxima First Strand cDNA Synthesis Kit (Thermo) and qRT-PCR was performed using SYBR Premix Ex Taq Kit (Takara). ..

    Article Title: mRNA-based in vivo induction of ETV2 to restore blood flow in a preclinical mouse hindlimb ischemia model
    Article Snippet: At 15, 24, 48, or 72 h, the cells were washed with PBS and lysed with RLT RNeasy Plus lysis buffer (a component of RNeasy Mini Kit, QIAGEN, Germantown, MD) containing 2-mercaptoethanol or radioimmunoprecipitation assay (RIPA) buffer containing phosphatase/protease inhibitors. .. Total RNA was extracted with an RNeasy Min kit and reverse transcribed to cDNA with a Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific), followed by RT-qPCR using TaqMan Probes and TaqMan fast Advanced Master Mix (Applied Biosystems, Waltham, MA) and CFX Opus 384 Real-Time PCR system (Bio-Rad, Hercules, CA) to assess mRNA expression levels of CDH5 , KDR , PECAM1 , and GAPDH (TaqMan Probes ID nos. .. Hs00901465_m1, Hs00911700_m1, Hs01065279_m1, and Hs02786624_g1).

    RNA Sequencing:

    Article Title: A pair of GPI-anchored proteins regulate soybean immunity and disease resistance in coordination with GmLMM1 and GmRALFs.
    Article Snippet: .. Samples were separated on an SDS-PAGE gel and protein interactions were examined by anti-HIS immunoblotting. qRT-PCR and RNA-seq assays Plant total RNA was isolated using Eastep Super Total RNA Extraction Kit (Promega) according to the manufacturer’s instructions. cDNA was synthesized using Maxima First Strand cDNA Synthesis Kit (Thermo) and qRT-PCR was performed using SYBR Premix Ex Taq Kit (Takara). ..

    Isolation:

    Article Title: A pair of GPI-anchored proteins regulate soybean immunity and disease resistance in coordination with GmLMM1 and GmRALFs.
    Article Snippet: .. Samples were separated on an SDS-PAGE gel and protein interactions were examined by anti-HIS immunoblotting. qRT-PCR and RNA-seq assays Plant total RNA was isolated using Eastep Super Total RNA Extraction Kit (Promega) according to the manufacturer’s instructions. cDNA was synthesized using Maxima First Strand cDNA Synthesis Kit (Thermo) and qRT-PCR was performed using SYBR Premix Ex Taq Kit (Takara). ..

    Article Title: Differential chromatin response to retinoic acid in neuroblastoma according to type of ATRX mutation
    Article Snippet: .. RNA was isolated from cells using the Qiagen RNeasy kit and cDNA synthesized using the Maxima First Strand cDNA synthesis kit (ThermoFisher). ..

    RNA Extraction:

    Article Title: A pair of GPI-anchored proteins regulate soybean immunity and disease resistance in coordination with GmLMM1 and GmRALFs.
    Article Snippet: .. Samples were separated on an SDS-PAGE gel and protein interactions were examined by anti-HIS immunoblotting. qRT-PCR and RNA-seq assays Plant total RNA was isolated using Eastep Super Total RNA Extraction Kit (Promega) according to the manufacturer’s instructions. cDNA was synthesized using Maxima First Strand cDNA Synthesis Kit (Thermo) and qRT-PCR was performed using SYBR Premix Ex Taq Kit (Takara). ..

    Synthesized:

    Article Title: A pair of GPI-anchored proteins regulate soybean immunity and disease resistance in coordination with GmLMM1 and GmRALFs.
    Article Snippet: .. Samples were separated on an SDS-PAGE gel and protein interactions were examined by anti-HIS immunoblotting. qRT-PCR and RNA-seq assays Plant total RNA was isolated using Eastep Super Total RNA Extraction Kit (Promega) according to the manufacturer’s instructions. cDNA was synthesized using Maxima First Strand cDNA Synthesis Kit (Thermo) and qRT-PCR was performed using SYBR Premix Ex Taq Kit (Takara). ..

    Article Title: Differential chromatin response to retinoic acid in neuroblastoma according to type of ATRX mutation
    Article Snippet: .. RNA was isolated from cells using the Qiagen RNeasy kit and cDNA synthesized using the Maxima First Strand cDNA synthesis kit (ThermoFisher). ..

    Real-time Polymerase Chain Reaction:

    Article Title: mRNA-based in vivo induction of ETV2 to restore blood flow in a preclinical mouse hindlimb ischemia model
    Article Snippet: At 15, 24, 48, or 72 h, the cells were washed with PBS and lysed with RLT RNeasy Plus lysis buffer (a component of RNeasy Mini Kit, QIAGEN, Germantown, MD) containing 2-mercaptoethanol or radioimmunoprecipitation assay (RIPA) buffer containing phosphatase/protease inhibitors. .. Total RNA was extracted with an RNeasy Min kit and reverse transcribed to cDNA with a Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific), followed by RT-qPCR using TaqMan Probes and TaqMan fast Advanced Master Mix (Applied Biosystems, Waltham, MA) and CFX Opus 384 Real-Time PCR system (Bio-Rad, Hercules, CA) to assess mRNA expression levels of CDH5 , KDR , PECAM1 , and GAPDH (TaqMan Probes ID nos. .. Hs00901465_m1, Hs00911700_m1, Hs01065279_m1, and Hs02786624_g1).

    Article Title: Senescence-associated alterations in histone H3 modifications, HP1 alpha levels and distribution, and in the transcriptome of vascular smooth muscle cells in different types of senescence.
    Article Snippet: .. Analysis of mRNA levels using real-time PCR (qPCR) The reverse transcription reaction was performed using the Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) according to the manufacturer’s instructions. .. The reaction was performed in a Mastercycler® nexus thermal cycler (Eppendorf ) using 1 μg of RNA isolated as described in 2.4.

    Article Title:
    Article Snippet: 32 June 2023 463 Molecular Therapy: Nucleic Acids DNA-free DNase Treatment (Thermo Fisher Scientific) was used to remove DNA contamination from the RNA samples. .. Total RNA was reverse transcribed into cDNA using the Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific), and qPCR was performed using the TaqMan ready-to-use primer-probe from Gene Expression Assay (Thermo Fisher Scientific): Angptl3 (Assay ID: Mm00803820_ m1). mRNA expression levels were normalized to mouse Actb (Assay ID: Mm01205647_g1) as an internal control, and the level of gene expression was calculated relative tomiSCR-injected mice. .. Liver miAngE measurements in WT and dyslipidemic mice RNA was extracted from mouse livers as previously described and reverse transcribed using the TaqManMicroRNA Reverse Transcription kit (Thermo Fisher Scientific) and a custom stem-loop primer specific for miAngE 23 nucleotide (variant T).

    Expressing:

    Article Title: mRNA-based in vivo induction of ETV2 to restore blood flow in a preclinical mouse hindlimb ischemia model
    Article Snippet: At 15, 24, 48, or 72 h, the cells were washed with PBS and lysed with RLT RNeasy Plus lysis buffer (a component of RNeasy Mini Kit, QIAGEN, Germantown, MD) containing 2-mercaptoethanol or radioimmunoprecipitation assay (RIPA) buffer containing phosphatase/protease inhibitors. .. Total RNA was extracted with an RNeasy Min kit and reverse transcribed to cDNA with a Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific), followed by RT-qPCR using TaqMan Probes and TaqMan fast Advanced Master Mix (Applied Biosystems, Waltham, MA) and CFX Opus 384 Real-Time PCR system (Bio-Rad, Hercules, CA) to assess mRNA expression levels of CDH5 , KDR , PECAM1 , and GAPDH (TaqMan Probes ID nos. .. Hs00901465_m1, Hs00911700_m1, Hs01065279_m1, and Hs02786624_g1).

    Article Title:
    Article Snippet: 32 June 2023 463 Molecular Therapy: Nucleic Acids DNA-free DNase Treatment (Thermo Fisher Scientific) was used to remove DNA contamination from the RNA samples. .. Total RNA was reverse transcribed into cDNA using the Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific), and qPCR was performed using the TaqMan ready-to-use primer-probe from Gene Expression Assay (Thermo Fisher Scientific): Angptl3 (Assay ID: Mm00803820_ m1). mRNA expression levels were normalized to mouse Actb (Assay ID: Mm01205647_g1) as an internal control, and the level of gene expression was calculated relative tomiSCR-injected mice. .. Liver miAngE measurements in WT and dyslipidemic mice RNA was extracted from mouse livers as previously described and reverse transcribed using the TaqManMicroRNA Reverse Transcription kit (Thermo Fisher Scientific) and a custom stem-loop primer specific for miAngE 23 nucleotide (variant T).

    Gene Expression:

    Article Title:
    Article Snippet: 32 June 2023 463 Molecular Therapy: Nucleic Acids DNA-free DNase Treatment (Thermo Fisher Scientific) was used to remove DNA contamination from the RNA samples. .. Total RNA was reverse transcribed into cDNA using the Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific), and qPCR was performed using the TaqMan ready-to-use primer-probe from Gene Expression Assay (Thermo Fisher Scientific): Angptl3 (Assay ID: Mm00803820_ m1). mRNA expression levels were normalized to mouse Actb (Assay ID: Mm01205647_g1) as an internal control, and the level of gene expression was calculated relative tomiSCR-injected mice. .. Liver miAngE measurements in WT and dyslipidemic mice RNA was extracted from mouse livers as previously described and reverse transcribed using the TaqManMicroRNA Reverse Transcription kit (Thermo Fisher Scientific) and a custom stem-loop primer specific for miAngE 23 nucleotide (variant T).

    Control:

    Article Title:
    Article Snippet: 32 June 2023 463 Molecular Therapy: Nucleic Acids DNA-free DNase Treatment (Thermo Fisher Scientific) was used to remove DNA contamination from the RNA samples. .. Total RNA was reverse transcribed into cDNA using the Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific), and qPCR was performed using the TaqMan ready-to-use primer-probe from Gene Expression Assay (Thermo Fisher Scientific): Angptl3 (Assay ID: Mm00803820_ m1). mRNA expression levels were normalized to mouse Actb (Assay ID: Mm01205647_g1) as an internal control, and the level of gene expression was calculated relative tomiSCR-injected mice. .. Liver miAngE measurements in WT and dyslipidemic mice RNA was extracted from mouse livers as previously described and reverse transcribed using the TaqManMicroRNA Reverse Transcription kit (Thermo Fisher Scientific) and a custom stem-loop primer specific for miAngE 23 nucleotide (variant T).



    Similar Products

    97
    Quanta Biosciences maxima first strand cdna synthesis kit
    Maxima First Strand Cdna Synthesis Kit, supplied by Quanta Biosciences, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/maxima+first+strand+cdna+synthesis+kit/qScript+cDNA+Synthesis+Kit/10__1016_slash_j__celrep__2025__116194-692-20-37
    Average 97 stars, based on 1 article reviews
    maxima first strand cdna synthesis kit - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    99
    New England Biolabs monarch total rna miniprep kit neb t2010 maxima first strand cdna synthesis kit
    Monarch Total Rna Miniprep Kit Neb T2010 Maxima First Strand Cdna Synthesis Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/maxima+first+strand+cdna+synthesis+kit/Monarch+Total+RNA+Miniprep+Kit/10__1038_slash_s44319___025___00555___w-224-85-90
    Average 99 stars, based on 1 article reviews
    monarch total rna miniprep kit neb t2010 maxima first strand cdna synthesis kit - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    86
    Fisher Scientific maxima first strand cdna synthesis kit
    Maxima First Strand Cdna Synthesis Kit, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/maxima+first+strand+cdna+synthesis+kit/capacity+cdna+high+kit+reverse+transcription/pmc12764766-404-9-21
    Average 86 stars, based on 1 article reviews
    maxima first strand cdna synthesis kit - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    90
    Thermo Fisher maxima first strand cdna synthesis kit
    Synthetic mRNA encoding ETV2 is efficiently translated into functional protein in vitro (A) EGFP or ETV2 protein expression at 15 h after mRNA transfection with MessengerMAX. Representative blight filed image and fluorescence image. Scale bars, 75 μm. TF, transfection reagent. (B) After mRNA transfection with MessengerMAX, the cells were collected at 24, 48, or 72 h time point. Total RNA extraction, <t>cDNA</t> <t>synthesis,</t> and qPCR analysis by ΔΔCT method were conducted. For each condition, n = 4; mean ± SD. ∗∗ p < 0.01 by two-way ANOVA with Bonferroni correction. (C) CDH5 protein expression at 24, 48, and 72 h time points after mRNA transfection were analyzed by western Blotting. The number above each gel lane represent the fold-change in intensity relative to control (TF only, 24 h).
    Maxima First Strand Cdna Synthesis Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/maxima+first+strand+cdna+synthesis+kit/revertaid+first+strand+cdna+synthesis+kit/pmc12221739-160-16-22
    Average 90 stars, based on 1 article reviews
    maxima first strand cdna synthesis kit - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher maxima h minus first strand cdna synthesis kit, with dsdnase
    Synthetic mRNA encoding ETV2 is efficiently translated into functional protein in vitro (A) EGFP or ETV2 protein expression at 15 h after mRNA transfection with MessengerMAX. Representative blight filed image and fluorescence image. Scale bars, 75 μm. TF, transfection reagent. (B) After mRNA transfection with MessengerMAX, the cells were collected at 24, 48, or 72 h time point. Total RNA extraction, <t>cDNA</t> <t>synthesis,</t> and qPCR analysis by ΔΔCT method were conducted. For each condition, n = 4; mean ± SD. ∗∗ p < 0.01 by two-way ANOVA with Bonferroni correction. (C) CDH5 protein expression at 24, 48, and 72 h time points after mRNA transfection were analyzed by western Blotting. The number above each gel lane represent the fold-change in intensity relative to control (TF only, 24 h).
    Maxima H Minus First Strand Cdna Synthesis Kit, With Dsdnase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/maxima+first+strand+cdna+synthesis+kit/revertaid+first+strand+cdna+synthesis+kit/pmc12205603-41-9-11
    Average 90 stars, based on 1 article reviews
    maxima h minus first strand cdna synthesis kit, with dsdnase - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher maxima first-strand cdna synthesis kit
    Synthetic mRNA encoding ETV2 is efficiently translated into functional protein in vitro (A) EGFP or ETV2 protein expression at 15 h after mRNA transfection with MessengerMAX. Representative blight filed image and fluorescence image. Scale bars, 75 μm. TF, transfection reagent. (B) After mRNA transfection with MessengerMAX, the cells were collected at 24, 48, or 72 h time point. Total RNA extraction, <t>cDNA</t> <t>synthesis,</t> and qPCR analysis by ΔΔCT method were conducted. For each condition, n = 4; mean ± SD. ∗∗ p < 0.01 by two-way ANOVA with Bonferroni correction. (C) CDH5 protein expression at 24, 48, and 72 h time points after mRNA transfection were analyzed by western Blotting. The number above each gel lane represent the fold-change in intensity relative to control (TF only, 24 h).
    Maxima First Strand Cdna Synthesis Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/maxima+first+strand+cdna+synthesis+kit/revertaid+first+strand+cdna+synthesis+kit/bio_rxiv__2025__07__15__664962-239-9-18
    Average 90 stars, based on 1 article reviews
    maxima first-strand cdna synthesis kit - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher maxima first strand cdna synthesis kit for rt-qpcr #k1641
    Synthetic mRNA encoding ETV2 is efficiently translated into functional protein in vitro (A) EGFP or ETV2 protein expression at 15 h after mRNA transfection with MessengerMAX. Representative blight filed image and fluorescence image. Scale bars, 75 μm. TF, transfection reagent. (B) After mRNA transfection with MessengerMAX, the cells were collected at 24, 48, or 72 h time point. Total RNA extraction, <t>cDNA</t> <t>synthesis,</t> and qPCR analysis by ΔΔCT method were conducted. For each condition, n = 4; mean ± SD. ∗∗ p < 0.01 by two-way ANOVA with Bonferroni correction. (C) CDH5 protein expression at 24, 48, and 72 h time points after mRNA transfection were analyzed by western Blotting. The number above each gel lane represent the fold-change in intensity relative to control (TF only, 24 h).
    Maxima First Strand Cdna Synthesis Kit For Rt Qpcr #K1641, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/maxima+first+strand+cdna+synthesis+kit/revertaid+first+strand+cdna+synthesis+kit/pm40664266-78-16-18
    Average 90 stars, based on 1 article reviews
    maxima first strand cdna synthesis kit for rt-qpcr #k1641 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    Synthetic mRNA encoding ETV2 is efficiently translated into functional protein in vitro (A) EGFP or ETV2 protein expression at 15 h after mRNA transfection with MessengerMAX. Representative blight filed image and fluorescence image. Scale bars, 75 μm. TF, transfection reagent. (B) After mRNA transfection with MessengerMAX, the cells were collected at 24, 48, or 72 h time point. Total RNA extraction, cDNA synthesis, and qPCR analysis by ΔΔCT method were conducted. For each condition, n = 4; mean ± SD. ∗∗ p < 0.01 by two-way ANOVA with Bonferroni correction. (C) CDH5 protein expression at 24, 48, and 72 h time points after mRNA transfection were analyzed by western Blotting. The number above each gel lane represent the fold-change in intensity relative to control (TF only, 24 h).

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: mRNA-based in vivo induction of ETV2 to restore blood flow in a preclinical mouse hindlimb ischemia model

    doi: 10.1016/j.omtn.2025.102592

    Figure Lengend Snippet: Synthetic mRNA encoding ETV2 is efficiently translated into functional protein in vitro (A) EGFP or ETV2 protein expression at 15 h after mRNA transfection with MessengerMAX. Representative blight filed image and fluorescence image. Scale bars, 75 μm. TF, transfection reagent. (B) After mRNA transfection with MessengerMAX, the cells were collected at 24, 48, or 72 h time point. Total RNA extraction, cDNA synthesis, and qPCR analysis by ΔΔCT method were conducted. For each condition, n = 4; mean ± SD. ∗∗ p < 0.01 by two-way ANOVA with Bonferroni correction. (C) CDH5 protein expression at 24, 48, and 72 h time points after mRNA transfection were analyzed by western Blotting. The number above each gel lane represent the fold-change in intensity relative to control (TF only, 24 h).

    Article Snippet: Total RNA was extracted with an RNeasy Min kit and reverse transcribed to cDNA with a Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific), followed by RT-qPCR using TaqMan Probes and TaqMan fast Advanced Master Mix (Applied Biosystems, Waltham, MA) and CFX Opus 384 Real-Time PCR system (Bio-Rad, Hercules, CA) to assess mRNA expression levels of CDH5 , KDR , PECAM1 , and GAPDH (TaqMan Probes ID nos.

    Techniques: Functional Assay, In Vitro, Expressing, Transfection, Fluorescence, RNA Extraction, cDNA Synthesis, Western Blot, Control